Complete Sequence and Analysis of Plastid Genomes of Two Economically Important Red Algae: Pyropia haitanensis and Pyropia yezoensis

نویسندگان

  • Li Wang
  • Yunxiang Mao
  • Fanna Kong
  • Guiyang Li
  • Fei Ma
  • Baolong Zhang
  • Peipei Sun
  • Guiqi Bi
  • Fangfang Zhang
  • Hongfan Xue
  • Min Cao
چکیده

BACKGROUND Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics. PRINCIPAL FINDINGS We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp) and P. yezoensis (191,975 bp), the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs), 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146) was much smaller than that of Porphyra purpurea and P. haitanensis (0.250), and P. yezoensis (0.251); this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved. CONCLUSIONS These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene content yet found reveal that Pyropia are more primitive multicellular red algae.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

An Efficient PCR-RFLP Method for the Rapid Identification of Korean Pyropia Species.

The present study utilizes polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using partial plastid rbcL and mitochondrial trnC-trnP gene sequences to distinguish the six representative Pyropia species produced via mariculture in Korea. The rbcL, trnC, and trnP sequences of 15 Pyropia species from the NCBI database were aligned to determine specific restricti...

متن کامل

Minimally destructive sampling of type specimens of Pyropia (Bangiales, Rhodophyta) recovers complete plastid and mitochondrial genomes

Plant species, including algae and fungi, are based on type specimens to which the name of a taxon is permanently attached. Applying a scientific name to any specimen therefore requires demonstrating correspondence between the type and that specimen. Traditionally, identifications are based on morpho-anatomical characters, but recently systematists are using DNA sequence data. These studies are...

متن کامل

Effect of Different Light Qualities on Growth, Pigment Content, Chlorophyll Fluorescence, and Antioxidant Enzyme Activity in the Red Alga Pyropia haitanensis (Bangiales, Rhodophyta)

Spectral light changes evoke different morphogenetic and photosynthetic responses that can vary among different algae species. The aim of this study is to investigate the photosynthetic characteristics of the red macroalgae grown under different spectrum environments. In this study, Pyropia haitanensis were cultured under blue, red, and green LED and fluorescent tubes light. The growth rate, ph...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

The First Symbiont-Free Genome Sequence of Marine Red Alga, Susabi-nori (Pyropia yezoensis)

Nori, a marine red alga, is one of the most profitable mariculture crops in the world. However, the biological properties of this macroalga are poorly understood at the molecular level. In this study, we determined the draft genome sequence of susabi-nori (Pyropia yezoensis) using next-generation sequencing platforms. For sequencing, thalli of P. yezoensis were washed to remove bacteria attache...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 8  شماره 

صفحات  -

تاریخ انتشار 2013